Metadata-Version: 2.1
Name: genomic_benchmarks
Version: 0.0.6
Summary: Genomic Benchmarks
Home-page: https://github.com/ML-Bioinfo-CEITEC/genomic_benchmarks
Author: RBP Bioinformatics
Author-email: ML.Bioinfo.CEITEC@gmail.com
License: Apache License 2.0
Description: # Genomic Benchmarks 🧬🏋️✔️
        
        In this repository, we collect benchmarks for classification of genomic sequences. It is shipped as a Python package, together with functions helping to download & manipulate datasets and train NN models. 
        
        ## Hackathon 2021-11-19
        
        We have collected a list of genomic datasets and are now organizing the ML hackathon to train classifiers over them. Would you join us on Friday, [November 19, 2021, 15:00 CET](https://www.timeanddate.com/worldclock/converter.html?iso=20211119T140000&p1=204&p2=136&p3=179&p4=224&p5=33&p6=176&p7=248) at [CEITEC MU](https://www.ceitec.cz/), Brno, Czechia 🇨🇿🇪🇺, or remotely? Free refreshment for all participants, swag for the winners. The event is both competitive (to prove your ML models are the best) and a learning opportunity (we will provide all the help we can). 
        
        * Final datasets and evaluation metrics will be provided on the day of the hackathon. In principle, they will be similar to datasets currently included in this package.
        * You can participate both in person at CEITEC or remotely. More information at [bit.ly/genomichackathon](https://bit.ly/genomichackathon), sign up [here](https://forms.gle/s7zoqpzXmjU6yATm6). No prior knowledge about DNA/RNA/genetics needed (you must be able to code in Python and know ML basics).
        * To participate on-site, you must be vaccinated, recovered or tested (O-N-T regulations analogical to German G3 apply). Please, bring FFP2 mask.
        
        ## Install
        
        Genomic Benchmarks can be installed as follows:
        
        ```bash
        pip install genomic-benchmarks
        ```
        
        To use it with papermill, TF or pytorch, install the corresponding dependencies:
        
        ```bash
        # if you want to use jupyter and papermill
        pip install jupyter>=1.0.0
        pip install papermill>=2.3.0
        
        # if you want to train NN with TF
        pip install tensorflow>=2.6.0
        pip install tensorflow-addons
        pip install typing-extensions --upgrade  # fixing TF installation issue
        
        # if you want to train NN with torch
        pip install torch>=1.10.0
        pip install torchtext
        
        ```
        
        For the package development, use Python 3.8 (ideally 3.8.9) and the installation described [here](README_devel.md).
        
        ## Usage
        Get the list of all datasets with the `list_datasets` function
        
        ```python
        >>> from genomic_benchmarks.data_check import list_datasets
        >>> 
        >>> list_datasets()
        ['demo_coding_vs_intergenomic_seqs', 'demo_mouse_enhancers', 'human_nontata_promoters', 'human_enhancers_cohn', 'demo_human_or_worm', 'human_enhancers_ensembl']
        ```
        
        You can get basic information about the benchmark with `info` function:
        
        ```python
        >>> from genomic_benchmarks.data_check import info
        >>> 
        >>> info("human_nontata_promoters", version=0)
        Dataset `human_nontata_promoters` has 2 classes: negative, positive.
        
        All lenghts of genomic intervals equals 251.
        
        Totally 36131 sequences have been found, 27097 for training and 9034 for testing.
                  train  test
        negative  12355  4119
        positive  14742  4915
        ```
        
        The function `download_dataset` downloads the full-sequence form of the required benchmark (splitted into train and test sets, one folder for each class). If not specified otherwise, the data will be stored in `.genomic_benchmarks` subfolder of your home directory. By default, the dataset is obtained from our cloud cache (`use_cloud_cache=True`). 
        
        ```python
        >>> from genomic_benchmarks.loc2seq import download_dataset
        >>> 
        >>> download_dataset("human_nontata_promoters", version=0)
        Downloading 1VdUg0Zu8yfLS6QesBXwGz1PIQrTW3Ze4 into /home/petr/.genomic_benchmarks/human_nontata_promoters.zip... Done.
        Unzipping...Done.
        PosixPath('/home/petr/.genomic_benchmarks/human_nontata_promoters')
        ```
        
        Getting TensorFlow Dataset for the benchmark and displaying samples is straightforward: 
        
        ```python
        >>> from pathlib import Path
        >>> import tensorflow as tf
        >>> 
        >>> BATCH_SIZE = 64
        >>> SEQ_TRAIN_PATH = Path.home() / '.genomic_benchmarks' / 'human_nontata_promoters' / 'train'
        >>> CLASSES = ['negative', 'positive']
        >>> 
        >>> train_dset = tf.keras.preprocessing.text_dataset_from_directory(
        ...     directory=SEQ_TRAIN_PATH,
        ...     batch_size=BATCH_SIZE,
        ...     class_names=CLASSES)
        Found 27097 files belonging to 2 classes.
        >>> 
        >>> list(train_dset)[0][0][0]
        <tf.Tensor: shape=(), dtype=string, numpy=b'TCCTGCCTTTCCACTTGCACCAGTTTTCCCACCCCAGCCTCAGGGCGGGGCTGCCTCGTCACTTGTCTCGGGGCAGATCTGCCCTACACACGTTAGCGCCGCGCGCAAAGCAGCCCCGCAGCACCCAGGCGCCTCCTGGCGGCGCCGCGAAGGGGCGGGGCTGTCGGCTGCGCGTTGTGCGCTGTCCCAGGTTGGAAACCAGTGCCCCAGGCGGCGAGGAGAGCGGTGCCTTGCAGGGATGCTGCGGGCGG'>
        ```
        See [How_To_Train_CNN_Classifier_With_TF.ipynb](notebooks/How_To_Train_CNN_Classifier_With_TF.ipynb) for more detailed description how to train CNN classifier with TensorFlow.
        
        Getting Pytorch Dataset and displaying samples is also easy:
        ```python
        >>> from genomic_benchmarks.dataset_getters.pytorch_datasets import HumanNontataPromoters
        >>> 
        >>> dset = HumanNontataPromoters(split='train', version=0)
        >>> dset[0]
        ('CAATCTCACAGGCTCCTGGTTGTCTACCCATGGACCCAGAGGTTCTTTGACAGCTTTGGCAACCTGTCCTCTGCCTCTGCCATCATGGGCAACCCCAAAGTCAAGGCACATGGCAAGAAGGTGCTGACTTCCTTGGGAGATGCCATAAAGCACCTGGATGATCTCAAGGGCACCTTTGCCCAGCTGAGTGAACTGCACTGTGACAAGCTGCATGTGGATCCTGAGAACTTCAAGGTGAGTCCAGGAGATGT', 0)
        ```
        See [How_To_Train_CNN_Classifier_With_Pytorch.ipynb](notebooks/How_To_Train_CNN_Classifier_With_Pytorch.ipynb) for more detailed description how to train CNN classifier with Pytorch.
        
        
        ## Introduction
        
        [WHY ARE BENCHMARKS IMPORTANT?]
        
        [WHAT BENCHMARKS ARE GENOMIC BENCHMARKS?]
        ## Structure of package
        
          * [datasets](datasets/): Each folder is one benchmark dataset (or a set of bechmarks in subfolders), see [README.md](datasets/README.md) for the format specification
          * [docs](docs/): Each folder contains a Python notebook that has been used for the dataset creation
          * [experiments](experiments/): Training a simple neural network model(s) for each benchmark dataset, can be used as a baseline
          * [notebooks](notebooks/): Main use-cases demonstrated in a form of Jupyter notebooks 
          * [src/genomic_benchmarks](src/genomic_benchmarks/): Python module for datasets manipulation (downlading, checking, etc.)
          * [tests](tests/): Unit tests for `pytest` and `pytest-cov`
        
        ## How to contribute
        
        TBD
        
Keywords: bioinformatics,genomics,data
Platform: UNKNOWN
Classifier: Development Status :: 3 - Alpha
Classifier: Intended Audience :: Developers
Classifier: Topic :: Software Development :: Build Tools
Classifier: License :: OSI Approved :: MIT License
Classifier: Programming Language :: Python :: 3.8
Classifier: Programming Language :: Python :: 3.9
Classifier: Programming Language :: Python :: 3.10
Description-Content-Type: text/markdown
